ADAMTS13, ADAM metallopeptidase with thrombospondin type 1 motif 13, 11093
N. diseases: 229; N. variants: 83
Source: ALL
Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
1.000 | 0.080 | 9 | 133439443 | frameshift variant | TT/- | del |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 9 | 133449851 | inframe deletion | TGCCCG/- | delins | 4.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 0 | ||||||||||
|
1.000 | 0.080 | 9 | 133448718 | missense variant | T/G | snv | 7.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.800 | 1.000 | 20 | 2001 | 2011 | |||||||
|
1.000 | 0.080 | 9 | 133454440 | missense variant | T/G | snv | 3.2E-05 | 1.2E-04 |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.800 | 1.000 | 20 | 2001 | 2011 | ||||||
|
9 | 133433011 | intron variant | T/G | snv | 5.7E-02 |
|
0.700 | 1.000 | 1 | 2018 | 2018 | ||||||||||
|
9 | 133434817 | intron variant | T/C;G | snv |
|
Nervous System Diseases; Cardiovascular Diseases | 0.010 | 1.000 | 1 | 2016 | 2016 | ||||||||||
|
1.000 | 0.080 | 9 | 133426056 | missense variant | T/C | snv |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 1.000 | 20 | 2001 | 2011 | ||||||||
|
1.000 | 0.080 | 9 | 133426266 | missense variant | T/C | snv |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 1.000 | 20 | 2001 | 2011 | ||||||||
|
1.000 | 0.080 | 9 | 133443413 | missense variant | T/C | snv | 4.5E-06 |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 1.000 | 20 | 2001 | 2011 | |||||||
|
9 | 133424254 | intron variant | T/C | snv | 0.68 |
|
Neoplasms; Hemic and Lymphatic Diseases | 0.010 | 1.000 | 1 | 2019 | 2019 | |||||||||
|
9 | 133424254 | intron variant | T/C | snv | 0.68 |
|
Nervous System Diseases; Cardiovascular Diseases | 0.010 | 1.000 | 1 | 2016 | 2016 | |||||||||
|
9 | 133427946 | intron variant | T/C | snv | 0.34 |
|
0.700 | 1.000 | 1 | 2018 | 2018 | ||||||||||
|
0.882 | 0.160 | 9 | 133442718 | missense variant | T/C | snv |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 0 | |||||||||||
|
0.882 | 0.160 | 9 | 133442718 | missense variant | T/C | snv |
|
Pathological Conditions, Signs and Symptoms; Skin and Connective Tissue Diseases; Cardiovascular Diseases | 0.700 | 0 | |||||||||||
|
0.882 | 0.160 | 9 | 133442718 | missense variant | T/C | snv |
|
Hemic and Lymphatic Diseases | 0.700 | 0 | |||||||||||
|
0.882 | 0.160 | 9 | 133442718 | missense variant | T/C | snv |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 0 | |||||||||||
|
0.882 | 0.160 | 9 | 133442718 | missense variant | T/C | snv |
|
0.700 | 0 | ||||||||||||
|
0.882 | 0.160 | 9 | 133442718 | missense variant | T/C | snv |
|
Hemic and Lymphatic Diseases | 0.700 | 0 | |||||||||||
|
0.882 | 0.160 | 9 | 133442718 | missense variant | T/C | snv |
|
Pathological Conditions, Signs and Symptoms | 0.700 | 0 | |||||||||||
|
0.882 | 0.160 | 9 | 133442718 | missense variant | T/C | snv |
|
Pathological Conditions, Signs and Symptoms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 9 | 133428642 | missense variant | T/A | snv |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 1.000 | 20 | 2001 | 2011 | ||||||||
|
1.000 | 0.080 | 9 | 133432639 | missense variant | T/A | snv |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 1.000 | 20 | 2001 | 2011 | ||||||||
|
1.000 | 0.080 | 9 | 133424431 | frameshift variant | GGAGGACACAGAGCGCTATGTGCTCACCA/- | delins | 4.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 0 | ||||||||||
|
1.000 | 0.080 | 9 | 133456543 | missense variant | G/T | snv |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 1.000 | 20 | 2001 | 2011 | ||||||||
|
0.882 | 0.160 | 9 | 133426240 | missense variant | G/T | snv |
|
Pathological Conditions, Signs and Symptoms; Hemic and Lymphatic Diseases | 0.700 | 0 |